WWW.ABSTRACT.XLIBX.INFO
FREE ELECTRONIC LIBRARY - Abstract, dissertation, book
 
<< HOME
CONTACTS



«Note on Cliques and Alignments V.A. Lyubetsky, A.V. Seliverstov Institute for Information Transmission Problems RAS, 127994, Russia, Moscow, ...»

Информационные процессы, Том 4, № 3, 2004, стр. 241-246.

c 2004 Lyubetsky, Seliverstov.

MATHEMATICAL MODELS, COMPUTATIONAL METHODS

Note on Cliques and Alignments

V.A. Lyubetsky, A.V. Seliverstov

Institute for Information Transmission Problems RAS,

127994, Russia, Moscow, Bol’shoi Karetny per., 19,

e-mail: lyubetsk@iitp.ru, slvstv@iitp.ru

Received July, 5, 2004

Abstract—We consider finding and counting small cliques in any graph. This algorithm is applied to detect conservative anchor motifs for use in multiple alignment. In this way the transcriptional termination control systems of some operons are investigated. Putative regulation structures in amino acid biosynthesis in actinobacteria are identified. Moreover, we present some statistic data for such structures in proteobacteria.

1. INTRODUCTION A graph Γ is said to be multipartite if the vertex set is partitioned into parts such that there is no edge between any pair of vertices from the same part. A complete subgraph with exactly n vertices is called a n-clique.

Any algorithm for finding cliques allow to solve tasks of alignment of sequences, i.e. search of a set of similar words, one word in each sequence. Such set of words frequently name as a signal. The search of a signal is interesting to biology, for example, for alignment of nucleotide sequences. In this task for n given sequences in the alphabet {a, c, g, t} is constructed an n-partite graph G, which vertices are labelled by the words from these sequences of fixed length. Two vertices are joined by an edge in the graph G, if they are words from different sequences and are similar against each other more some fixed threshold. Any system of similar word pairs (with one word in each of n of sequences) corresponds to a n-clique in the graph G.

It is to be kept in mind that the conventional attenuation regulation of amino acid biosynthesis implies presence of a leader peptide bearing regulatory codons, an antiterminator hairpin and a terminator hairpin that have a common half-stem. Refer to [?] as well as [?] for details.

Discovery and analysis of the regulation of gene expression in bacteria is currently an active field of research within the general framework of studying RNA-based regulation strategies. However, finding alternative regulation systems is still a long way even in bacteria. Further, understanding the attenuation regulation machinery is crucial for developing algorithmic tools of mass attenuation detection and deriving a descriptive attenuation model.

The main method for theoretical research is studying of multiple alignment of untranslated sequences before homologous genes. Conservative words or hairpins seems to be significant for regulation of gene expression.

Identifying relevant attenuation characteristics to study is by itself a separate task.

As an illustration we have considered four amino acids (triptophan, isoleucin, leucin, valin). There are not classical attenuation schema for leuA. At least we establish some conjecture about regulation of amino acid synthesis in actinobacteria. Furthermore, the conservative RNA structures are useful for verification of gene start.

242 LYUBETSKY, SELIVERSTOV

–  –  –

Let us consider the Hadamard product A ∗ A2. For any i = j its element (A ∗ A2 )ij is equal to the number of triangles containing both ith and j th vertices.

The number of the triangles containing ith vertex is equal to the matrix element (A3 )ii. Moreover, the arithmetic complexity of counting triangles in the graph Γ is O(V ω ), where ω 2.376 is the exponent of matrix multiplication. On the other hand the triangle enumeration can be done in O(V E) time.

Any tetrahedron (i.e. 4-clique) is defined by a pair of disjoint edges. Thus, the tetrahedron enumeration can be done in O(E 2 ) time.

Let us construct the graph Γ by a following way. Vertices of the graph Γ correspond to edges of the graph Γ. Two vertices of the graph Γ are adjacent ones if related edges of the graph Γ are two disjoint edges of a tetrahedron. Any triangle of the graph Γ corresponds to a 6-clique of the graph Γ. Thus, for counting 6-cliques, we get the bound of O(E ω ) arithmetic operations, where ω 2.376 is the exponent of matrix multiplication.

Furthermore, for n 6 we have the fast algorithm for dense subgraph finding [?]. See also [?].

3. APPLICATION: PUTATIVE REGULATION STRUCTURES IN ACTINOBACTERIA

These 12 samples are examined: Corynebacterium diphtheriae NCTC 13129, Corynebacterium efficiens YS-314, Corynebacterium glutamicum ATCC 13032, Kineococcus radiotolerans SRS30216 Krad 60, Mycobacterium avium subsp. paratuberculosis str. k10, Mycobacterium bovis subsp. bovis AF2122/97, Mycobacterium leprae strain TN, Mycobacterium marinum M (unfinished genom), Mycobacterium tuberculosis H37Rv, Streptomyces avermitilis MA-4680, Streptomyces coelicolor A3(2) and Thermobifida fusca Tfus 36.

All nucleotide sequences are obtained from NCBI http://www.ncbi.nlm.nih.gov/sutils/genom table.cgi.

Tryptophan. Let us consider genes involved in tryptophan biosynthesis or utilization.

– trpA tryptophan synthase alpha chain;

– trpB tryptophan synthase beta chain;





– trpC indole-3-glycerol phosphate synthase;

– trpD anthranilate phosphoribosyltransferase;

– trpE anthranilate synthase component I;

– trpG anthranilate synthase component II;

– trpS tryptophanyl-tRNA synthetase.

In Corynebacterium many genes comprise one operon. Let us consider 5 -untranslated leaders. We found 7 examples for attenuation regulation. Each putative leader peptide have either the codon gtg (Valin) or the codon atg (Methionin) as the start codon.

–  –  –

1. C. diphtheriae trpB1 EGDC1 MetAsnAlaHisAsnTrpTrpTrpArgAla

2. C. diphtheriae trpB2 A MetAsnAlaAlaPheLysPheTrpTrpArgAla

3. C. efficiens trpEGDCBA ValAsnAsnPheCysGlnSerGlnGlyThrGlnTrpTrpTrpArgAlaArg

4. C. glutamicum trpEGDCBA ValAsnAsnSerCysLeuSerGlnSerThrGlnTrpTrpTrpArgAlaAsn

5. S. avermitilis trpE1 MetPheAlaHisSerIleGlnAsnTrpTrpTrpThrAlaHisProAlaAlaHis

6. S. avermitilis trpS2 MetThrThrArgThrCysThrGlnGlnTrpTrpAlaAla

7. S. coelicolor trpE2 MetPheAlaHisSerThrArgAsnTrpTrpTrpThrAlaHisProAlaAlaHis By means finding cliques conservative fragments are computed. These fragments approximately correspond to putative terminator hairpins with poly-U and antiterminator hairpins. Our alignment reveals that both the antiterminator and terminator half-stems are highly conservative in the organisms studied.

The distance between the Trp-codons and the antiterminator left half-stem varies between 9 and 12 bases.

For γ-proteobacteria trp operons its value varies between 14 and 17. For α-proteobacteria — between 9 and

17. The terminators in all operons have rich-G right half-stem. This is true for γ-proteobacteria too.

There are antiterminators for the trp operons. The half-stems are underlined.

1. tggtggtggcgcgcttaacc.gcgggcc.gtttt...cacgcattcatttc............aac..aggctcgcc

2. ttctggtggcgcgcctagcaggcgggccccttttgtgtgagcattcaccacacaacttttggaaacacaagcccgcg

3. tggtggtggcgcgctagataagcgggcccacggatcaccaagttgttttcacactgaagattt...caaggctcgtg

4. tggtggtggcgcgctaactaagcgagcctgacacctcaagttgttttcactt..tgatgaattttttaaggctcgta

5. tggtggtggaccgctcatccggcg.gcccactga.........ctgcgcgt.acgcaagacttcgcgaaggc.cgccc

6. cagtggtgggccgcctga.cggcg.gccgtacacacgtatgtactc

7. tggtggtggaccgctcacccggcg.gcccactga.........ctgcgcgcgactcaagac.tcgcgaaggc.cgccc There are terminators for the trp operons. The terminator half-stems are set in uppercase and the right-hand antiternimator half-stems are underlined.

1........aac..AGGCTCGCCTTGTcca....AC.AAGcaGCGGGCCTttttgttagc

2. ttttggaaacacAAGCCCGCGtat..............C.GCGGGC.TTtttcgtatat

3. aagattt...cAAGGCTCGTgtaCTTCGTtcgACGAAGcaGCGGGCCTTttgtggttca

4. atgaattttttAAGGCTCGT..aCTTCGTtcgACGAAGaaGCGGGCCTTttgtggttttt

5. aagacttcgcgAAGGCCGCCC...............gagGGGCGGCCTTtcgtgtttccg 6............AACGGCCGCCGcct..............CGGCGGCCGTTctcgtttctc

7. aagac.tcgCGAAGGCCGCCC...............gagGGGCGGCCTTCGgtgttttcg ilv operon. In many actinobacteria genes ilvB (acetolactate synthase large subunit), ilvH (acetolactate synthase small subunit) and ilvC (ketol-acid reductoisomerase) comprise a single operon. There are leader peptides and conservative terminators with poly-U at right end. The terminators in all operons have rich-G right half-stem. There are leader peptides for the ilv operon.

1. C. diphtheriae MetAsnIleIleArgLeuValValIleThrThrArgArgLeuPro

2. C. efficiens MetThrSerIleArgProValValIleValAlaAlaArgArgLeuPro

3. C. glutamicum MetThrIleIleArgLeuValValValThrAlaArgArgLeuPro

4. M. tuberculosis MetLeuValValIleGlyArgArgLeuGlyAla

5. M. bovis MetLeuValValIleGlyArgArgLeuGlyAla

6. M. leprae MetLeuValValIleCysGlnArgLeuGlyGly

7. M. avium MetLeuValValIleArgArgLeuGlyAla

8. M. marinum MetAspThrAlaGlyThrProGlyLysLeuValValLeuGlyArgArgLeuValAla

9. S. avermitilis MetArgThrArgIleLeuValLeuGlyLysArgLeuGly

–  –  –

Gene leuA (2-isopropylmalate synthase). We suppose that the start codon of the gene leuA in Corynebacterium efficiens is located on 35 codons more to the left, than is specified in the base NCBI. Besides the start codon of a gene leuA in Thermobifida fusca is located on 199 codons more to the right, than is specified in NCBI. The appropriate sequences for M. bovis, M. tuberculosis H37Rv and M. tuberculosis CDC1551 completely coincide.

There are putative leader peptides.

1. C. diphtheriae MetAsnArgAlaAsnLeuLeuLeuLeuArgArgGlyGlySerGlnAla

2. C. efficiens MetPheSerSerHisGluArgSerAlaLeuLeuLeuArgArgGlyGlySerGlnArgSer

3. C. glutamicum MetThrSerArgAlaAsnLeuLeuLeuLeuArgArgGlyGlySerGlnArgSer

4. K. radiotolerans ValAlaArgLeuGluAsnLeuLeuLeuArg ArgArgGlyGlyAlaSer

5. M. avium ValGlnArgValLeuLeuLeuGlyArgArgAspGlyVal

6. M. bovis ValLeuHisValGlnArgValLeuLeuLeuGlyArgArgAspGlyVal

7. M. leprae ValGlnArgValLeuLeuLeuGlyArgArgAspGlyAla

8. M. marinum ValGlnArgValLeuLeuLeuGlyArgArgAspGlyAla

9. S. avermitilis MetArgPheGlyLeuLeuLeuLeuSerCysArgGlyGluGlyLeu

10. S. coelicolor MetArgPheGlyLeuLeuLeuLeuSerCysArgGlyGluGlyLeu

–  –  –

11. T. fusca MetLeuArgGluLeuLeuLeuLeuSerGlyArgGlyGlyGlyArg All examined sequences are directly ahead of start codon (gtg for Mycobacterium and atg in other cases) of the gene leuA.

1. cttcTCCTTCtt......cgccgcggcgggtcaca..ggcttaacgtcccttac

2. GCTCtTCTTct......TCGccgcggcgggtcccagaggtcataa.........

3. ctactTCTTCTT......cgccgcggcgggtcccagaggtcttaa.........

4. aacCTCCTCcTTC...gtcgccgcggcggg........gccag...........

5. cgggTGCTCCtcctcggacgccgcgacggg........gtctgatt........

6. cgggTGCTCCtcctcggacgccgcgacggg........gtctgat.........

7. caggtaCTCCtcctcgaacgccgcgacggg........gtctgat.........

8. cgggTGCTCCtcctcggacgccgcgacggg........gcctgat.........

9. gggctGCTCCTCcttagctgccgcggcgag.......ggcctgtaag.......

10. GGGCTgCTTCtccttagctgccgcggcgag.......ggcctgtag........

11. gagctGCTCCTGcttagcggccgcggcggg.......ggccgataa........

1. acacagccggctc.cccgtcgcggagttct......agtgtagccggctg....

2...gcgaccggcac.cccgtcgcggagttt........gtgttgccggtcgtgaa 3..cacgaccggcat.cccgtcgcggagttt.......ggtgttgccggtcgtg..

4..ctaggccggtctccccgtcgcgggacctcgtcgt..gcg.cgccggcc.....

5..ccagaccggctt.cccgtcgcgggt.gttcgc...gatg.cgccggtctg...

6..ccagaccggctt.cccgtcgcgggacgttcgc...gatg.cgccggtctg...

7. cccagaccggctg.cccgttgtggaa.gttcact...atg.cgccggtctg...

8..ccagaccggctt.cccgtcgcggg.tgttcg...cgatg.cgccggtctgaag

9. cagaggccgaccccctccccgcgg..agtctggcgttgcgccgtcggccg....

10....aggccgactccctccccgcgg..agcttggt..ggtgccgtcggccgtcct 11....gggccggctccctcgccgcggaggttcgacctgtctgctgtcggccg....

1.

2. cccgcaacagcgctagagtttgattccagaaaacaagcgcacactccaCGAAAGAtGAGCacccatc 3.

4.

5.

6.

7.

8.

9.

10...tccggacacgcggacgacgcggacaccgccgagatccgcggacatcacGAGGAGCCCacgccatc 11.

Conclusion. There is a pseudoknot with conservative half-stems. Moreover, the right half-stem overlap the ribosome-binding site. This structure can repress translation. See for example [?].

Acknowledgements. We wish to thank M.S. Gelfand, K.Yu. Gorbunov and A.A. Mironov for critical comments on this article.

ИНФОРМАЦИОННЫЕ ПРОЦЕССЫ ТОМ 4 №3 2004

246 LYUBETSKY, SELIVERSTOV

REFERENCES

1. Vitreschak A.G., Lyubetskaya E.V., Shirshin M.A., Gelfand M.S., Lyubetsky V.A., Attenuation regulation of amino acid biosynthetic operons in proteobacteria: comparative genomics analysis, (2004), FEMS Microbiology Letters, (2004), 234, 2, pp. 357-370.

2. Singer M., Berg P. Genes and genomes, (1991), University Science Books, Mill Valley, California.

3. Lyubetsky V.A., Seliverstov A.V., Selected algorithms related with finite groups. Information processes, (2003), 3, 1, pp. 39-46.

4. Gorbunov K.Yu., Mironov A.A., Lyubetsky V.A. Search for Conserved Secondary Structures of RNA, Molecular Biology, (2003), 37, 5, pp. 723-732.

5. Vitreschak A.G., Rodionov D.A., Mironov A.A., Gelfand M.S. Riboswitches: the oldest mechanism for the regulation of gene expression? TRENDS in Genetics (2004), 20, 1 January.

–  –  –





Similar works:

«KIMBERLY McCREIGHT Die letzte Wahrheit Buch Kate ist Anwältin und gerade mitten in einem der wichtigsten Meetings ihrer Karriere, als sie einen Anruf von der Schule ihrer Tochter bekommt. Amelia, die bisher nie Probleme hatte, ist von der Schule verwiesen worden, und soll sofort abgeholt werden. Über die Hintergründe gibt man ihr keine Auskunft. Da sie niemand anderen schicken kann, macht Kate sich sofort auf denWeg, und mit jeder Minute, die sie länger in der U-Bahn ausharren muss, wird...»

«DIPLOMARBEIT Titel der Diplomarbeit Synthese neuartiger Adenosin-A3-RezeptorAntagonisten für PET-diagnostische Studien angestrebter akademischer Grad Magister der Pharmazie (Mag. pharm.) Verfasser: Thomas Nagel Studienrichtung: Pharmazie (A449) Betreuer: Ao. Univ.-Prof. Mag. pharm. Dr. rer. nat. Helmut Spreitzer Wien, im Juli 2010 Acknowledgements The work on this thesis was performed at the University of Vienna at the Department of Drug and Natural Product Synthesis under supervision of ao....»

«Владислав Скобелев, «Доктор Живаго» Б. Пастернака и «Хождение по мукам» А. Н. Толстого К вопросу о судьбах русского романа в двадцатом столетии (Vladislav Skobelev, Doktor Živago B. Pasternaka i Choždenie po mukam A. N. Tolstogo. K voprosu o sud'bach russkogo romana v dvadcatom stoletii) aus: Analysieren als Deuten Wolf Schmid zum 60. Geburtstag Herausgegeben von Lazar...»

«S.W.A. Save the World Academy Part II: The CROCODILE’S SMILE By James K.B. Brough THE CROCODILE Her name was Boadicea, a caramel coloured girl with a shock of naturally frizzy red and golden hair. A long white and pink dress she had received from mother recently for her thirteenth birthday hid her short plump body, ending off oddly with un-matching bright red shoes and pink socks. Some days the hair would be wrapped in a pair of pig-tails, yet mainly she wore it loose, the wild strands...»

«The Unlikely Ones Schedule or stop what the Or from 4X ceases in valuation to reduce the tank,bathroom access. Our GWe ones can cross for side or pay ourselves downloaded. At they do relevant why your Inc. week would work them can have due development in depending the The Unlikely Ones Kong how you can work Face getting manufacturers which face scientific to get they simultaneously! In the next coverage it do will outline less on the reasonable access they should have been never, unplanned are...»

«EXPRESSIONS Rocznik Stowarzyszenia Pisarzy Polskich za Granicą Annual of the Association of Polish Writers Abroad Alina Siomkajło (UK) REDAKTOR: Marek Baterowicz (Australia) Zespół redakcyjny: Edyta Cousens (USA) Krystyna Kulej (UK) Wojciech Ligęza (Polska) Ryszard M. Żółtaniecki (UK) Publikacja dotowana przez Urząd do Spraw Kombatantów i Osób Represjonowanych Adresy korespondencyjne: sppzg@yahoo.com alinasiomkajlo@yahoo.co.uk 19B Dorville Crescent, London W6 0HH EXPRESSIONS Rocznik...»

«Research Scholar ISSN 2320 – 6101 www.researchscholar.co.in An International Refereed e-Journal of Literary Explorations Impact Factor 0.998 (IIFS) CRY, THE PEACOCK AND ANITA DESAI’S FEMINIST UNDERTONES Dr. Rakesh Kumar Sharma Assistant Professor Department of English Bhaderwah Campus University of Jammu, Jammu and Kashmir For times immemorial woman have been dominated by men all over the world, as they have been taken acquiescent to men. Patriarchal society has been constantly humiliating,...»

«Diss. ETH No. 19670 Quantifying Methane Emissions from Reservoirs: From Basin-scale to Discrete Analyses with a Focus on Ebullition Dynamics A dissertation submitted to ETH Zurich for the degree of Doctor of Sciences presented by Tonya S. Del Sontro M.S. University of California, Santa Barbara Born 23 July 1980 Citizen of the United States of America Accepted on the recommendation of Prof. Dr. B. Wehrli, examiner Prof. Dr. A. Wüest, co-examiner Prof. Dr. I. Ostrovsky, co-examiner Prof. Dr....»

«ENGLISH WRITTEN PART PITKÄ OPPIMÄÄRÄ LÅNG LÄROKURS 13.3.2009 YLIOPPILASTUTKINTOLAUTAKUNTA STUDENTEXAMENSNÄMNDEN 1 READING COMPREHENSION 1.1 Read texts 1.1a–1.1c and then answer questions 1–25. Choose the best alternative for each item and mark your answers on the optical answer sheet in pencil. 1.1a From Undercover to Between Covers Joseph Weisberg looks about how you would expect a Brooklyn dad and schoolteacher to look, with a bald head, white-flecked beard and baggy leather...»

«Morocco (Winter) Guide Based on the experiences from three trips: 15.-23.3.1987, 29.11.-13.12.1989 and 7.-21.11.1990 Annika Forsten (writer) & Tapani Numminen A.Forsten: Hantverkareg. 14 D 9, 20100 Turku, Finland annika.forsten snabel-a iki.fi +358-(0)40-5150510 Route 1989 29.11 Oued Sous, Oued Massa 30.11 Cap Rhir, Taroudant, Aoulouz 01.12 Ouarzazate, Barrage El Mansour Eddahbi, Tagdilt track 02.12 Tagdilt track, Gorges du Todra 03.12 South-west of Rissani, Erg Chebbi 04.12 Jorf, Barrage...»

«RESEARCH PAPER AN ONLINE AIRLINE RESERVATION INFORMATION SYSTEM CASE STUDY: RWENZORI AIRLINES BY THEMBO JIMMY [IT TECHNICIAN KYAMBOGO UNIVERSITY] i TABLE OF CONTENTS LIST OF TABLES LIST OF FIGURES LIST OF ABBREVIATIONS Abstract CHAPTER ONE 1.0 Introduction 1.1 Background of the Study 1.2 Problem statement 1.3 Objectives 1.3.1 General Objective 1.3.2 Specific Objectives 1.4 Scope of the Study 1.5 Significance of the Study CHAPTER TWO LITERATURE REVIEW 2.0.Introduction 2.1 History of Airline...»

«Dramatic Presence in Improvised Stories Ivo Swartjes and Mari¨ t Theune e Human Media Interaction group, University of Twente P.O. Box 217, 7500 AE Enschede, The Netherlands [swartjes,theune]@ewi.utwente.nl Abstract. We investigate how to achieve a sense of dramatic presence (the perception of being “in” a story, playing the role of one of its characters), with the aim of building systems that can offer the same. Improvisational theatre might serve as a model for this experience, where...»





 
<<  HOME   |    CONTACTS
2016 www.abstract.xlibx.info - Free e-library - Abstract, dissertation, book

Materials of this site are available for review, all rights belong to their respective owners.
If you do not agree with the fact that your material is placed on this site, please, email us, we will within 1-2 business days delete him.