WWW.ABSTRACT.XLIBX.INFO
FREE ELECTRONIC LIBRARY - Abstract, dissertation, book
 
<< HOME
CONTACTS



Pages:   || 2 | 3 |

«Annemarie Tuin, Alie de Jager-Krikken, Lisette Bok1, Willem Raaben2, Markwin P. Velders2, Dirk K.F. Meijer, Klaas Poelstra and Gerard Dijkstra1 ...»

-- [ Page 1 ] --

Chapter 6

Oral administration of alkaline

phosphatase ameliorates colitis

Annemarie Tuin, Alie de Jager-Krikken, Lisette Bok1, Willem Raaben2,

Markwin P. Velders2, Dirk K.F. Meijer, Klaas Poelstra and Gerard Dijkstra1

Department of Pharmacokinetics and Drug Delivery, University Centre for Pharmacy,

University of Groningen, The Netherlands

1 Department of Gastroenterology and Hepatology, University Medical Centre Groningen,

The Netherlands

2 AM-Pharma, Bunnik, The Netherlands

Submitted Chapter 6 Abstract Background & Aims: Crohn’s disease (CD) and ulcerative colitis (UC) are chronic multifactorial inflammatory bowel diseases with unknown etiology, but a dysregulated mucosal immune response to gut-derived bacterial antigens is thought to be involved. Toll-like receptor ligands, especially lipopolysaccharide (LPS), seem to contribute in the maintenance of the disease. Previously, we showed that the enzyme alkaline phosphatase (AP) is able to detoxify LPS and the aim of this study was therefore to examine its role in inflammatory bowel diseases.

Methods: We examined intestinal AP (iAP) mRNA expression and LPSdephosphorylation in intestinal biopsies of control persons and IBD patients, and we studied the effect of orally administered acid-protected enteric coated iAPtablets on the progression of dextran sodium sulphate-induced colitis in rats.

Results: In healthy persons, iAP mRNA and protein expression was high in the ileum relative to the colon. iAP mRNA expression was not altered in CD patients, but it was markedly reduced in UC patients when inflamed tissue was compared to non-inflamed tissue. Oral administration of iAP-tablets to colitic rats resulted in a significant attenuation of colonic inflammation as reflected by reduced mRNA levels for TNFα, IL-1β, IL-6 and iNOS, a reduced iNOS-staining and inflammatory cell influx, and a significantly improved morphology of the intestinal wall.

Conclusions: The present study shows that epithelial iAP mRNA expression is clearly reduced in UC patients. The rat colitis model showed that oral administration of iAP can not only replenish the intestinal tract with active APenzymes, but also results in a significant reduction of gut inflammation. This may provide new opportunities for the treatment of IBD.

Oral administration of alkaline phophatase ameliorates colitis Introduction Crohn's disease (CD) and ulcerative colitis (UC) are inflammatory bowel diseases (IBD) of the digestive tract that are thought to result from inappropriate and ongoing activation of the mucosal immune system driven by the presence of the normal luminal flora (1). The exact causes of IBD are still unclear but environmental factors, genetic predisposition and immunologic disorders are suggested to be involved. Mutations in several genes, like NOD2/CARD15 during CD (2) and TLR4 during CD and UC (3; 4), seem to predispose for IBD. The intracellular protein encoded by the NOD2 gene is thought to interact with bacterial products like peptidoglycans (5; 6) and TLR4 is the signaling receptor for lipopolysaccharide (LPS). Deficiencies in response mechanisms against bacterial products, including LPS, thus seem to be an important factor in IBD.

Alkaline phosphatase (AP) has been found to dephosphorylate LPS (7-10), which results in the formation of a non-toxic lipid A group within the LPS molecule. In general, the lipid A group of LPS harbours 2 phosphate groups that are responsible for the toxicity of LPS and AP was shown to remove at least one of these phosphate groups. This enzyme is abundantly present along the microvilli in the small intestine of all species (11), indicating a possible role in the protection of the host against endotoxins.

As AP is able to detoxify LPS and response mechanisms against LPS are changed during IBD, we wondered whether the levels of AP are changed in the intestines of IBD patients. Therefore, iAP mRNA expression and LPS-dephosphorylation in intestinal biopsies of control persons and IBD patients were determined.

Furthermore, we studied the efficacy of orally administrated acid-resistant iAPtablets on dextran sodium sulphate-induced colitis in rats. In this study, we show that epithelial iAP expression is decreased in UC patients and that oral iAP administration ameliorates LPS-mediated symptoms in colitic rats. In colon biopsies of IBD patients, a response to LPS was only observed when the epithelial layer was affected by ulcerations. These observations provide novel insights and a rationale for new therapeutic strategies against IBD through augmentation of LPS detoxification in the intestinal lumen.

Chapter 6

Materials & Methods Patient characteristics / specimen collection Intestinal mucosal biopsy specimens were obtained during endoscopy following informed consent (approved by the Ethics Committee of the University Medical Centre Groningen) from patients with Crohn’s disease (CD), ulcerative colitis (UC) and control subjects. Patient characteristics are described in table 1. Diagnosis of IBD was established by endoscopic and histopathological examination. The group control subjects were referred to our endoscopy centre because of polyp surveillance or changed stool frequency. In control subjects, biopsies were obtained from 4 different intestinal areas (ileum, ascending colon, transverse colon, and rectum). Biopsies from IBD patients were obtained from the rim of ulceration’s or aphtoid lesions if present and from macroscopic non-inflamed areas using a standard biopsy forceps. Intestinal specimens were immediately snap-frozen in liquid nitrogen for mRNA and protein analysis or liquid nitrogen-cooled isopentane for immunohistochemical staining, and stored at –80°C until further processing. For LPS incubation experiments, biopsies from the transverse colon were immediately incubated after endoscopy.





–  –  –

Enzymehistochemical detection of AP activity LPS-dephosphorylation by human iAP was examined in cryostat sections (5 µm) of biopsies of human ileum and colon (ascendens, descendens and rectum) with LPS as a substrate as described previously (12). The specificity of this staining has been demonstrated before using the iAP-inhibitor L-phenylalanine (13). LPS was omitted in control incubations.

Oral administration of alkaline phophatase ameliorates colitis

Incubation of human intestinal biopsies Per patient, 8 biopsies were collected and immediately put in 6-well plates containing 2 ml William’s medium E supplemented with glucose (final conc. 25 mM), gentamicin (final conc. 50 µg/ml), amphotericin B (final conc. 2.5 µg/ml) and 1% human serum. Of the 8 biopsies, 2 were incubated in medium only (controls), 2 in medium plus 500U AP, 2 in medium plus 10 µg/ml LPS and 2 in medium plus 500U AP and 10 µg/ml LPS. After 4 hr incubation in a CO2-incubator, biopsies were snap-frozen in liquid nitrogen and stored at –80°C until RNA isolation.

RNA isolation and real-time PCR RNA was isolated from incubated human intestinal biopsies using the QIAGEN RNeasy Mini Kit and subsequently converted to cDNA with the Promega Reverse Transcription System. The cDNA was amplified with appropriate primers (Table 2) by quantitative real-time PCR using SYBR Green (Applied Biosystems) and products were detected using the ABI PRISM 7900HT Detection System. Relative quantification of the genes was calculated using the comparative threshold cycle (CT) method as described by Van de Bovenkamp, using GAPDH as a housekeeping gene (14).

–  –  –

In vivo experiments To examine whether exogenous iAP affects experimental colitis, a colonic inflammation was induced in male Sprague-Dawley rats by dextran sodium sulphate (DSS). The rats were divided in four groups; 1: normal drinking water and placebo-tablets (n=5), 2: normal drinking water and iAP-tablets (n=5), 3: 5% DSS in drinking water and placebo-tablets (n=10) and 4: 5% DSS in drinking water and iAP-tablets (n=10). Both the iAP- and placebo-tablets had a diameter of 5.3 mm and an enteric coating, consisting of eudragit L, triethylcitraat and talc, to prevent dissolution in the stomach, which would destroy the activity of acid-sensitive AP enzymes. The pH at which the tablets dissoluted was determined at 5.5. The APtablets contained 1250 glycine units iAP (specific activity: 1035 units/mg protein), as determined by a standard enzyme activity assay.

–  –  –

IL-6 CCGGAGAGGAGACTTCACAG ACAGTGCATCATCGCTGTTC

iNOS CGTTCGATGTTCAAAGCAAA CCCTGGACTTCTCACTCTGC

IL-10R GCCCAGAGACTCTCGATGAC AAGACCCTTCCTTTCCCAGA

–  –  –

Oral treatment consisted of daily administration of a tablet, under isofluran/O2/N2O anaesthesia, from day 1 to 7 after start of the DSS administration.

From day 1 to 8, the rats were daily weighed, their consumption of drinking water was measured and their condition was scored using a standard scoring-procedure.

At day 8, the rats were anaesthetized with isofluran/O2/N2O and sacrificed by heart puncture. Faeces were collected for measurement of AP activity. The colon was harvested and scored macroscopically by examining whether there was distension

Oral administration of alkaline phophatase ameliorates colitis

(score 1), partial distension (score 0.5) or no distension (score 0) and whether the serosa was thickened (score 1), partially thickened (score 0.5) or not thickened at all (score 0). The proximal, middle and distal part of the colon were scored separately and all scores were summed. Thereafter, the colon was weighed, the length was measured and tissues samples of the distal part were stored for RNA isolation and real-time PCR analysis, as described above, for several genes (Table 3).

The rest of the colon was filled with Tissue-Tek®, rolled up and frozen in isopentane for histochemical analysis.

AP activity in faeces Homogenates of approximately 1 gram/ml rat faeces in water were centrifuged at 2000 rpm to spin down insoluble materials. The supernatant was removed and centrifuged at 13000 rpm to completely remove insoluble materials. Samples were diluted 0, 2, 4, 8, 16, 32, 64 and 128 times in a 96-wells plate in 0.05 M ammediol buffer containing 2 mM MgCl2. After addition of 10 µl of 10 mg/ml 4-nitrophenyl phosphate disodium salt, the plate was incubated for 30 min at 37°C. The reaction was stopped by adding 105 µl 1N NaOH. The ODs were measured at 405 nm on a Thermomax microplate reader.

Immunohistochemistry The H&E staining was performed according to standard procedures.

Myeloperoxidase (MPO) activity in activated neutrophils was visualized according to Poelstra (15). This staining was inhibitable by catalase. The staining for iNOS was done according to standard indirect immunoperoxidase techniques with a rabbit polyclonal antibody directed against iNOS and GARPO (DAKO) as the secondary antibody. The iNOS antibody was developed in the laboratory of dr. H.

Moshage (University of Groningen, The Netherlands) and has been described previously (16). Peroxidase activity was visualized with 3-amino-9-ethylcarbazole.

The staining for villin was performed like the iNOS-staining using a goat polyclonal antibody against villin (sc-7672, Santa Cruz) and RAGPO and GARPO as a secondary respectively third antibody (both from DAKO).

Chapter 6

Statistical analysis Statistical analysis of patient data was done by an unpaired two-tailed Student’s ttest, assuming similar variances, and expressed as the mean ± the S.D. The data of the animal experiment were subjected to a non-parametric one-sided MannWhitney U test, because these data were not normally distributed. Differences were considered significant at p 0.05.

Results LPS-dephosphorylation and iAP mRNA levels in healthy human intestinal biopsies To investigate whether the human small intestine and colon have LPSdephosphorylating activity, cryostat sections of biopsies of human terminal ileum, colon ascendens, colon transversum and rectum of healthy persons were examined. Results from the enzymehistochemical analysis showed that the cells in sections of human ileum have a high LPS-dephosphorylating activity as demonstrated by a brown lead sulphate precipitate along the apical side of the microvilli of the enterocyte (Fig. 1A). In contrast, LPS-dephosphorylation was absent in human colon sections; colon ascendens, colon transversum and rectum (Fig. 1B, C and D). These reactions were also negative when a conventional substrate for AP (β-glycerophosphate) was used. Occasional cells stained positive, which probably reflects AP activity in macrophages and endothelial cells of small blood vessels. When LPS was omitted from the incubation medium, no staining was detected (Fig. 1E).

In addition to LPS-dephosphorylation, the biopsies were inspected for their intestinal AP mRNA levels. As previous studies have shown that AP can dephosphorylate LPS (7; 8), AP expression levels may be indicative for the LPSdetoxifying capacity of the intestine. iAP mRNA levels in the human ileum were found to be about 30 times higher than those in the human colon (Fig. 2).

Figure 1: LPS dephosphorylation by sections of the intestine of a normal healthy person (a full color version of this figure is depicted on page 172). A brown staining was clearly visible along the apical side of the microvilli of the enterocyte in the terminal ileum (A). In contrast, biopsies from the colon ascendens (B), colon transversum (C) and rectum (D), showed hardly any LPS-dephosphorylating activity along the enterocytes. Occasional cells stained positive (arrows). Control sections (without LPS) were completely negative (E).

Magnification 200*.

–  –  –

Figure 2: Intestinal iAP expression throughout the human colon and in the ileum. Biopsies were taken from healthy subjects (n=6) and analyzed for iAP mRNA levels by real time RTPCR. Expression levels of iAP mRNA were related to the average expression level in the colon transversum. Values are expressed as mean ± SD, * = p 0.005 versus ileum.



Pages:   || 2 | 3 |


Similar works:

«UCC1: New Course Transmittal Form Microbiology and Cell Science 60100000 Department Name and Number Recommended SCNS Course Identi cation U R N 3 1 7 Pre x Level Course Number Lab Code Genetics & Genomics in Health Care Full Course Title Transcript Title (please limit to 21 characters) Genetics in Nursing Fall 2013 E ective Term and Year Rotating Topic yes no Amount of Credit Contact Hour: Base or Headcount S/U Only yes s no Repeatable Credit yes s no If yes, total repeatable credit allowed...»

«EXPRESSION OF THE EDWARDSIELLA ICTALURI TYPE III SECRETION SYSTEM AND ITS RELATIONSHIP TO THE NATIVE PLASMIDS A Dissertation Submitted to the Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College in partial fulfillment of the requirements for the degree of Doctor of Philosophy in The Interdepartmental Program in Veterinary Medical Sciences through the Department of Pathobiological Sciences by Matthew Rogge B.S., University of Wisconsin – Stevens Point,...»

«Бюллетень медицинских Bulletin of Medical Интернет-конференций Internet Conferences ISSN 2224-6150 ISSN 2224-6150 2015. Том 5. Выпуск 4 (Апрель) 2015. Volume 5. Issue 4 (April) Учредитель журнала – Общество с ограниченной ответственностью Publisher – Limited Liability Company Science and Innovation (Saratov, «Наука и Инновации» (Россия, Саратов) Russia)...»

«Regulating Smoking in Multi-Unit Housing / 1 Tips and Tools Regulating Smoking in Multi-Unit Housing The Tobacco Control Legal Consortium has created this series of legal technical assistance guides to serve as a starting point for organizations interested in implementing certain tobacco control measures. We encourage you to consult with local legal counsel before attempting to implement these measures.1 For more details about these policy considerations, please contact the Consortium....»

«105 Forum Is the Bellagio consensus statement on the use of contraception sound public-health policy? James Trussell and Gigi Santow Office of Population Research, Princeton University, 21 Prospect Avenue, Princeton, NJ 08544–2091, USA. Health Transition Centre, NCEPH, ANU. Conventional public health wisdom suggests that breastfeeding has an important fertility-reducing effect for a population but is an unreliable contraceptive for an individual woman or couple (Hatcher et al. 1989, 1990)....»

«Andrew A. DWYER Complete CV Clinical Specialist / Research Manager Andrew A. DWYER Service of Endocrinology, Diabetes and Metabolism University Hospital, CHUV Rue du Bugnon 46 BH 19-317 CH – 1011 Lausanne, Switzerland Tel : +41 (0)21 314 06 25 Fax : +41 (0)21 314 06 30 General information Education Cornell University, Ithaca, NY 1988-1992 College of Human Ecology Bachelor of Science, Human Development & Family Studies Massachusetts General Hospital Institute of Health Professions, Boston,...»

«Healthcare Missions Conference PROCEEDINGS TABLE OF CONTENTS SPEAKERS Abstract PAGE THE CHURCH AND SHALOM Gil Odendaal, PhD NS SHALOM, HEALTH, HEALING AND WHOLENESS: Bryant Myers, PhD 3 THEOLOGICAL REFLECTIONS Fuller Theological Seminary BLESSED ARE THE SHALOM-MAKERS: THE ROLE OF Beth Snodderly, D. Litt et Phil and 3-4 Brian Lowther THE HEALTH PROFESSIONAL IN THE CHURCH William Carey International University and Roberta Winter Institute  “JESUS WEPT”: WHY CHRISTIAN CARE...»

«Chapter Two A Question of Intellectual Property, circa the Fifteenth Century This controversy between midwifery and medicine may well be one of the first organized conflicts over “intellectual property”, occurring long before that concept found a voice in the late 20th century. The intellectual property in question belongs communally to childbearing women and their midwives. Midwifery as an organized body of knowledge and set of technical skills preceded the modern discipline of medicine by...»

«Intel® Entry Storage System SS4000-E Benutzerhandbuch Ein Handbuch für technisch qualifizierte Monteure von Intel® Gehäusebaugruppen und Produkten Intel-Bestellnummer D39172-002 Haftungsausschluss Die Informationen in diesem Dokument beziehen sich auf Produkte von Intel®. Dieses Dokument gewährt keine Lizenz auf irgendwelche Urheberrechte, weder ausdrücklich oder stillschweigend noch durch Verwirkung oder anderes. Außer wie in den Verkaufsund Lieferbedingungen von Intel für solche...»

«Thomas King: Primary and Secondary Sources Primary Sources King, Thomas, Calver, Cheryl, Hoy, Helen, eds. The Native in Literature: Canadian and Comparative Perspectives. Toronto : ECW Press, 1987. King, Thomas. “Introduction: an anthology of Canadian native fiction.” Canadian Fiction Magazine. (Jun 1987): 4. King, Thomas. Medicine River. Markham, Ont. : Viking, 1990, 1989. King, Thomas. Introduction. All my relations : an anthology of contemporary Canadian native fiction. King ed. Toronto...»

«Medizintechnik in Deutschland Zukunftsbranche Medizintechnik – Auch im Norden ein Wachstumsmotor Studie im Auftrag der HSH Nordbank AG PD Dr. Michael Bräuninger, HWWI Dr. Eckhardt Wohlers, HWWI I Medizintechnik in Deutschland 3 Inhalt 4 I 1. Management Summary 5 I 2. Medizinprodukte international ein attraktiver Wachstumsmarkt 7 I 3. Deutschland ein guter Standort für Medizintechnik 7 I 3.1 Medizintechnik im Spiegel der Statistik 8 I 3.2 Struktur und Entwicklung der Medizintechnik in...»

«Ontology Enrichment from Free-text Clinical Documents: A Comparison of Alternative Approaches by Kaihong Liu Doctor in Medicine, Beijing University of Chinese Medicine, 1987 Master of Science in Biomedical Informatics, University of Pittsburgh, 2007 Submitted to the Graduate Faculty of School of Medicine in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Pittsburgh UNIVERSITY OF PITTSBURGH SCHOOL OF MEDICINE This dissertation was presented by Kaihong...»





 
<<  HOME   |    CONTACTS
2016 www.abstract.xlibx.info - Free e-library - Abstract, dissertation, book

Materials of this site are available for review, all rights belong to their respective owners.
If you do not agree with the fact that your material is placed on this site, please, email us, we will within 1-2 business days delete him.